splitting without delimiters..

hi

i need to split a string ATTATCGATGATATTATTGGTCTTATTTGT into each alphabet..

after splitting each index of the array should hold each alphabet eg. splitseq (0) = A, splitseq(1) = T n so on till the end of the sequence..

FYI its a gene sequence and im using vb.net

pls reply urgently…..!!!!